Perl script web pagePekerjaan

Filter

Pencarian saya terakhir
Filter menurut:
Anggaran
hingga
hingga
hingga
Tipe
Keahlian
Bahasa
    Pernyataan Pekerjaan
    7,748 perl script web page pekerjaan ditemukan, seharga USD
    PERL Modification Berakhir left

    Greetings, I had some custom work done before on a pl which searches for link popularity. This script searches for user-inputted urls and searches for them on search engines. Currently it DOES work but I want it improved. I want the results in a color format depending on number of results. Ie. 0-299 links found would show up blue. The results will be

    $23 (Avg Bid)
    $23 Rata-rata
    4 penawaran
    84182 FSDC Berakhir left

    I have a web page that currently tracks data based on date that uses a perl script and a csv flat file and I want it moved to php and mysql. The things I need are: Retreives data from mysql db and displays date according to parameters on web page Allows users to enter data in mysql db based on access rights via web interface. Allows Admin to en...

    $265 (Avg Bid)
    $265 Rata-rata
    1 penawaran

    ...YOU DO NOT PLAN TO FINISH IT OR IF YOU DO NOT HAVE PREVIOUS EXPERIENCE WITH SIMILAR DEVELOPMENTS! THANK YOU. PROJECT Start Page Exchange - complete website REQUIRED FEATURES User login/registration Mailing list Database Web-administration Form handling As needed SIMILAR SITES [login untuk melihat URL] [login untuk melihat URL] Is it hard

    N/A
    N/A
    0 penawaran

    ...write some simple C++ and Perl programs as the deliverables describes. These programs will need to compile and run in an Unix environment. ## Deliverables Complete and fully-functional working program(s) in executable form as well as complete source code of all work done. !!LOOK BELOW!! Write a program (in C/C++ or perl) to simulate the busy-wait

    $44 (Avg Bid)
    $44 Rata-rata
    2 penawaran

    We run slackware 7.1 kernel 2.4.5 Need to have perl script to work with single entry form page. Must be able to work with current configuration. Must work with out having to change permission in /etc. script and form is at the floowing URL. [login untuk melihat URL] [login untuk melihat URL] Thanks

    $27 (Avg Bid)
    $27 Rata-rata
    3 penawaran

    Need to have the script at the link below modified to accept one user name from a 1 field form and restore their access. [login untuk melihat URL] Thanks Bob Ross ## Deliverables Complete and fully-functional working program(s) in executable form as well as complete source code of all work done.

    $10 (Avg Bid)
    $10 Rata-rata
    1 penawaran
    Modify perl script Berakhir left

    Need to have perl code that is used to send email from a web page modified. Instead of the code using the [login untuk melihat URL] file for the names of the users to send to, we want the code to read the /etc/passwd file for the users to send to. With the [login untuk melihat URL] file for those not to send an email to like root, etc.. or other users that don't

    $52 (Avg Bid)
    $52 Rata-rata
    18 penawaran

    ...which will update a mysql/postgres/oracle database. Anyone on the web who has registered with the site will be able to look at a real time stock holding. Each web page must be based on a header which checks that person accessing page has login rights. if not just take them to a login page. A facility to send data requests to the site using a url, e.g.

    PHP
    $1439 (Avg Bid)
    $1439 Rata-rata
    14 penawaran

    I need a simple web based application which involves the use of these 5 programing languages: PHP, Perl, awk, bash, sed ( I know sed is nota programing language, but must be included in the project :)) ) The application could be anything you want, a message board, a bug tracker system, an e-commerce site, anything, but It should be simple, and clean

    $99 (Avg Bid)
    $99 Rata-rata
    2 penawaran

    **Summary:** Need a custom perl (Open to PHP, or other language design) program designed that'll act as a shopping cart for my website, with versatile administrative capability. Have several specifications that I need that won't allow me to seek out and purchase a pre-designed package. Several things unique to my company, etc. It's nothing complex

    $316 (Avg Bid)
    $316 Rata-rata
    12 penawaran

    Again I'm looking for someone to write yet another script that will work properly. I have had two programers tell me this is fixed, and twice it does not work. I'm tired of paying for something that does not work. I need a web based script that will allow me to enter text to a web page. Sometime a little long. 4 or 5 paragraphs and send it to all

    $79 (Avg Bid)
    $79 Rata-rata
    8 penawaran

    This project is similar to one I have underway here currently(web client programming - search on 'dean'). I want to be able to navigate a password protected site and get and post to and from whatever pages I need. I can do this easily with my browser but am having either authentication problems with my scripts or perhaps since the dynamic pages are

    $127 (Avg Bid)
    $127 Rata-rata
    6 penawaran
    Email system users Berakhir left

    Again I'm looking for someone to re-write yet another script that will not work properly. I need a web based script that will allow me to enter text to a web page. Sometime a little long. 4 or 5 paragraphs and send it to all the users from our system. The list of users is a simple text file. user1 user2 user3 I want it to pause

    $39 (Avg Bid)
    $39 Rata-rata
    3 penawaran
    web directory Berakhir left

    ...program on my search engine/directory web site. Using Perl as the interpreter programming language, the Software Product is basically a set of source code written in a text file with the file extension either ".pl" or ".cgi". I have a domain hosted on an Apache/1.3.19 server using RedHat 7.1, FreeBSD, with CGI access, Perl 5, php, FTP access, FrontPage e...

    $51 (Avg Bid)
    $51 Rata-rata
    1 penawaran

    ...catching on very quickly. 1.) Need help to make this script receive user name from a web page and restore their access. [login untuk melihat URL] or write one that will. I don't care Your choice !!. 2.) The web page is not on the server for security reasons. It will be kept with admin. 3.) The script MUST work without having to change security. MUS...

    $46 (Avg Bid)
    $46 Rata-rata
    2 penawaran

    Need help to make this script receive user name from a web page and restore their access. [login untuk melihat URL] ## Deliverables Complete source code of all programming work done

    $46 (Avg Bid)
    $46 Rata-rata
    7 penawaran
    php perl programmer Berakhir left

    We are currently looking for PHP and Perl programmers who have had working commercial experience specifically related to site tracking, search engines and marketing projects. LONDON AREA ONLY Please send CV and any examples of work to: [login untuk melihat URL]@[login untuk melihat URL]

    $200 - $300
    Bersegel
    $200 - $300
    0 penawaran
    php perl programmer Berakhir left

    We are currently looking for PHP and Perl programmers who have had working commercial experience specifically related to site tracking, search engines and marketing projects. Please send CV and any examples of work to: [login untuk melihat URL]@[login untuk melihat URL]

    $200 - $300
    Bersegel
    $200 - $300
    0 penawaran
    Signup Page Berakhir left

    I run Linux Slackware 7.1 kernel 2.4.5 Need to create sign up page for potential customers. I need to create an on-line signup page. I already have a web based adduser that is used locally that adds users to the server instantly. The script is in perl. Can be integrated in to this one if need be. Stand alone is fine also. To be mentioned if included

    PHP
    $435 (Avg Bid)
    $435 Rata-rata
    7 penawaran
    Perl Database Berakhir left

    ...designed in perl which has the following features. Members login: one for guest:guest, one for paid members which they will create login:pass. All information for paid members will be stored on file and retrieved when login. No information, no anything, is saved for guest:guest users. When they login to either script, they will be able to use a perl-based

    $40 (Avg Bid)
    $40 Rata-rata
    7 penawaran

    ...do it easily with a browser but my perl script won't yet do the job. The site is https, requires a login and uses cookies/session key. The content is generated from a database (sql?) and is specific to my login. I have complete authorization to access site (this is not a break-in job), I just want to do it via script. What I would like to do is walk the

    $58 (Avg Bid)
    $58 Rata-rata
    3 penawaran

    Hi; I need a Perl coder/coders for some MODs I need done to a perl forum script. The actual program is UltraBoard 2000 2.23, which should be fairly generic code for any perl programmer. I can live with most of the out-of-package features, but there are specific mods that I would like. You can get a better idea by checking out my board at: http://207

    $106 (Avg Bid)
    $106 Rata-rata
    2 penawaran

    Im I need of a very basic Web based Project Managment Application. This must be completed using Perl or PHP with MySQL. Required features: Admin page: Allows you to view, create, delete projects. (When creating a new project, a new directory must be made in the root web dir and all files for project placed in the newly created dir. When deleting a project

    $121 (Avg Bid)
    $121 Rata-rata
    10 penawaran

    Send / Recieve mail directly from AOL servers using perl and linux. I provide Example Files: [login untuk melihat URL] contains 10 aol usernames (ScreenNames) one per line delimited by newlines. [login untuk melihat URL] contains a 300 Char Text Message. you will create: [login untuk melihat URL] a simple perl script that is easy to read and modify sendaolmail contains the fol...

    $100 - $500
    $100 - $500
    0 penawaran

    ...amount of fields, such as username, password, email address, home page title, home page url and (short) description). after purchasing script package from [login untuk melihat URL] and sharing my idea, he suggested I visit this site. ( I am using windows, but my domain is located where I can use perl-cgi/unix scripts.) Anyhow, I see lots of banner exchange scripts

    $100 (Avg Bid)
    $100 Rata-rata
    1 penawaran

    Hello, I wish to display the filesize next to each file printed in the array below Please note - the 2 array symbols are now an astrisk to allow me to send this email here at rent a coder.... I tried $ENV{'CONTENT_LENGTH'}hoping to do just that but had no luck? I would be gratefull if one of you pro's could help me add this tid bit to my view sub below, so that I may learn what I wa...

    $15 (Avg Bid)
    $15 Rata-rata
    3 penawaran

    Hello! I wish to display the filesize next to each file printed in the array below Please note - the 2 array symbols are now an astrisk to allow me to send this email here at rent a coder.... I tried $ENV{'CONTENT_LENGTH'}hoping to do just that but had no luck? I would be gratefull if one of you pro's could help me add this tid bit to my view sub below, so that I may learn what I wa...

    max $5
    max $5
    0 penawaran
    Perl CGI Projects Berakhir left

    Hello, We are currently looking for Perl programmers to help develop open source and commercial CGI products. You must have reasonable knowledge in any of the following areas: Perl Javascript Advanced HTML We would prefer it if you had previous experience at programming full products but it is not required. Programmers would benefit from a profit share

    $200 - $300
    Bersegel
    $200 - $300
    0 penawaran

    a script in either php or perl with mysql that's a clone of [login untuk melihat URL] with all thier features ## Deliverables Complete source code of all programming work done proof that it works

    $1640 (Avg Bid)
    $1640 Rata-rata
    5 penawaran

    I need a script that will pull email addresses and names from a mysql file and mass mail to 1000's of people which works in the backgroud with a confirmation after the mailing to let me know that it is done ## Deliverables The code must include a htlp form in which to enter the subject, body and from email address beofre sending the mailing. The

    $68 (Avg Bid)
    $68 Rata-rata
    5 penawaran
    PERL SCRIPT TWEAKS Berakhir left

    Hello, I am new at PERL and over the last month have produced a script to help me organize a single users data. Two things still need to be fixed. 1. The script is processing "" semi quotes and such entered in on the edit form. (This is currently hardcoded and simply opens a text file and overwrites it) How can I prevent this from occuring? 2. My showdates

    $21 (Avg Bid)
    $21 Rata-rata
    2 penawaran

    I need a program that starts with two parents parent1:TCGAGTGCCTCGATGACTAT parent2:GTTTTGGCAACAATGTAGGG This program should use a random method of choosing between crossover,mutation, and reporduction. Reproduction just simply compies the genetic code to the two children. Mutation basically mutates the genes and crossover, take half the genes, splits them and then combines them with the other chil...

    $144 (Avg Bid)
    $144 Rata-rata
    4 penawaran

    I have a perl script that I bought (Over a year ago.) to do a thumbnail gallery and included in the program was a picture thumbnailer. I need to get the picture thumbnailer setup as a separate program that I can use on other websites. What it does? I place any number of full sized pictures into a folder on the server. The cgi script goes out and grabs

    $25 (Avg Bid)
    $25 Rata-rata
    1 penawaran

    ...conversion of two C programs into two Perl based CGI scripts which will be invoked by either the HTTP “get” or “post” method. The C programs have two or so other C programs (and a header file) that they are dependant on. A number of the functions in these supporting C programs also need to converted into the appropriate Perl functions/modules to provide exactly

    $200 - $300
    Bersegel
    $200 - $300
    0 penawaran
    Perl Upload.cgi Berakhir left

    Need to transfer a unix - script to an win2000 machine. It`s an upload script. ## Deliverables The script must be checked - and then changed to work on a win2000 server. 1 function must be removed from the script. Please contact me for a copy of the file. ## Deadline information Only 320 lines of code for review. i think for an professional should

    $87 (Avg Bid)
    $87 Rata-rata
    8 penawaran
    Perl Trainer Wanted Berakhir left

    Possible week long training in London. Please e-mail with day rates etc.

    $200 - $300
    Bersegel
    $200 - $300
    0 penawaran

    Wanted hardcore serious experieced PERL programmers who should possess good OOP knowledge. Preference would be given to the people familiar with some of the important PERL modules. CGI programming knowledge is a plus. Contact without CV mentioning total years of experience and nationality. Location is UK/EU. Foreign nationals [login untuk melihat URL] azsx109@onebox

    $200 - $300
    Bersegel
    $200 - $300
    0 penawaran

    We require a freelance programmer to make small modifications to an ‘off the shelf’ perl script. Working remotely, in your own time our requirements are as follows: 1. Once the customer has placed the product(s) in to the basket, the final page, which collects the customer information, will be located on a remote secure server ([login untuk melihat URL]) We

    $200 - $300
    Bersegel
    $200 - $300
    0 penawaran

    [login untuk melihat URL]

    $200 - $300
    Bersegel
    $200 - $300
    0 penawaran

    ... I need a perl cgi script made. Basically, the perl script will verify a list of email addresses, and save the valid ones to a text file. I have found a perl module at [login untuk melihat URL] that I think does this. What I am wanting is for someone to take this module, or make their own, and provide to me a fully-functioning script, ready for

    $200 - $300
    Bersegel
    $200 - $300
    0 penawaran
    Perl Development Berakhir left

    We need to have a script built that will take information supplied in a form and then build a HTML page automatically into the correct directory structure on our servers. Would be interested in hearing from anyone that thinks they can do this. I very good example is NetCard located at [login untuk melihat URL]

    $200 - $300
    Bersegel
    $200 - $300
    0 penawaran

    ...a "low cost" CGI/Perl programmer to do two projects which may involve hacking existing scripts. Our budget is very limited, however, we are prepared to off-set the difference with advertising on our site including free job/project referrals. [login untuk melihat URL] will soon begin helping businesses and individuals find, compare and select web products and services

    $200 - $300
    Bersegel
    $200 - $300
    0 penawaran
    PHP/Perl Developer Berakhir left

    ...based Internet Consultancy specialising in small to large company Web Sites, due to expansion are seeking an experienced Lead/Senior Programmer to compliment our existing team. 2 x Perl, PHP, MYSQL developers with experience for programming for database dynamic driven E-commerce Web Sites. One more senior 3 years + and one junior with System Administration

    $200 - $300
    Bersegel
    $200 - $300
    0 penawaran

    Hi We have a requirement for a perl contrator to do some 'polishing' to existing code and to create some new modules. This person needs to based in the UK, either in Hampshire or Berkshire. The following skills are ideal: Perl, Unix, CGI Please drop me a mail or call for a chat on: 01256 411344 07989 140124 Thanks! Mark Hughes [login untuk melihat URL]

    $200 - $300
    Bersegel
    $200 - $300
    0 penawaran

    We require an individual with good, quality experience and skills working with perl and the CGI environment. In particular a full understanding of mod_perl and related performance issues and techniques. Work will involve design, migration and tuning of existing and new systems.

    $200 - $300
    Bersegel
    $200 - $300
    0 penawaran
    Perl CM system Berakhir left

    Hi We urgently require a experienced Perl programmer, to build a relatively simple Content Management System (mostly news articles) and a user database (access by username and password). We need someone to come in for a brief Wednesday 20th AM !! Please call JM Littman 0207 596 6700

    $200 - $300
    Bersegel
    $200 - $300
    0 penawaran

    I've been asked to develop the front end on a messaging site that will be wap enabled. If I'm going to take it on I need a good perl person to work with. You will be experienced with URLs of database driven sites using PHP/perl in your portfolio. If you know XML too I'll be particularly interested. For details of the job send in your skillset, URLs

    $200 - $300
    Bersegel
    $200 - $300
    0 penawaran
    basic perl script Berakhir left

    I'm looking for a freelance programmer to write me a form and a script. For an idea of what I'd like to achieve, take a look at the following page on [login untuk melihat URL] by phillip greenspun; [login untuk melihat URL] Scroll down the page a bit and you can see the readers comments. Phillip gives away the software that runs his site for free, but all

    $200 - $300
    Bersegel
    $200 - $300
    0 penawaran