Perl script web page jobs

Filter

Pencarian saya terakhir
Filter menurut:
Anggaran
hingga
hingga
hingga
Keahlian
Bahasa
    Pernyataan Pekerjaan
    7,726 perl script web page pekerjaan ditemukan, seharga USD

    Im I need of a very basic Web based Project Managment Application. This must be completed using Perl or PHP with MySQL. Required features: Admin page: Allows you to view, create, delete projects. (When creating a new project, a new directory must be made in the root web dir and all files for project placed in the newly created dir. When deleting a project

    $121 (Avg Bid)
    $121 Rata-rata
    10 penawaran

    Send / Recieve mail directly from AOL servers using perl and linux. I provide Example Files: [login untuk melihat URL] contains 10 aol usernames (ScreenNames) one per line delimited by newlines. [login untuk melihat URL] contains a 300 Char Text Message. you will create: [login untuk melihat URL] a simple perl script that is easy to read and modify sendaolmail contains the fol...

    $100 - $500
    $100 - $500
    0 penawaran

    ...amount of fields, such as username, password, email address, home page title, home page url and (short) description). after purchasing script package from [login untuk melihat URL] and sharing my idea, he suggested I visit this site. ( I am using windows, but my domain is located where I can use perl-cgi/unix scripts.) Anyhow, I see lots of banner exchange scripts

    $100 (Avg Bid)
    $100 Rata-rata
    1 penawaran

    Hello, I wish to display the filesize next to each file printed in the array below Please note - the 2 array symbols are now an astrisk to allow me to send this email here at rent a coder.... I tried $ENV{'CONTENT_LENGTH'}hoping to do just that but had no luck? I would be gratefull if one of you pro's could help me add this tid bit to my view sub below, so that I may learn what I wa...

    $15 (Avg Bid)
    $15 Rata-rata
    3 penawaran

    Hello! I wish to display the filesize next to each file printed in the array below Please note - the 2 array symbols are now an astrisk to allow me to send this email here at rent a coder.... I tried $ENV{'CONTENT_LENGTH'}hoping to do just that but had no luck? I would be gratefull if one of you pro's could help me add this tid bit to my view sub below, so that I may learn what I wa...

    max $5
    max $5
    0 penawaran
    Perl CGI Projects Berakhir left

    Hello, We are currently looking for Perl programmers to help develop open source and commercial CGI products. You must have reasonable knowledge in any of the following areas: Perl Javascript Advanced HTML We would prefer it if you had previous experience at programming full products but it is not required. Programmers would benefit from a profit share

    $200 - $300
    Bersegel
    $200 - $300
    0 penawaran

    a script in either php or perl with mysql that's a clone of [login untuk melihat URL] with all thier features ## Deliverables Complete source code of all programming work done proof that it works

    $1640 (Avg Bid)
    $1640 Rata-rata
    5 penawaran

    I need a script that will pull email addresses and names from a mysql file and mass mail to 1000's of people which works in the backgroud with a confirmation after the mailing to let me know that it is done ## Deliverables The code must include a htlp form in which to enter the subject, body and from email address beofre sending the mailing. The

    $68 (Avg Bid)
    $68 Rata-rata
    5 penawaran
    PERL SCRIPT TWEAKS Berakhir left

    Hello, I am new at PERL and over the last month have produced a script to help me organize a single users data. Two things still need to be fixed. 1. The script is processing "" semi quotes and such entered in on the edit form. (This is currently hardcoded and simply opens a text file and overwrites it) How can I prevent this from occuring? 2. My showdates

    $21 (Avg Bid)
    $21 Rata-rata
    2 penawaran

    I need a program that starts with two parents parent1:TCGAGTGCCTCGATGACTAT parent2:GTTTTGGCAACAATGTAGGG This program should use a random method of choosing between crossover,mutation, and reporduction. Reproduction just simply compies the genetic code to the two children. Mutation basically mutates the genes and crossover, take half the genes, splits them and then combines them with the other chil...

    $144 (Avg Bid)
    $144 Rata-rata
    4 penawaran

    I have a perl script that I bought (Over a year ago.) to do a thumbnail gallery and included in the program was a picture thumbnailer. I need to get the picture thumbnailer setup as a separate program that I can use on other websites. What it does? I place any number of full sized pictures into a folder on the server. The cgi script goes out and grabs

    $25 (Avg Bid)
    $25 Rata-rata
    1 penawaran

    ...conversion of two C programs into two Perl based CGI scripts which will be invoked by either the HTTP “get” or “post” method. The C programs have two or so other C programs (and a header file) that they are dependant on. A number of the functions in these supporting C programs also need to converted into the appropriate Perl functions/modules to provide exactly

    $200 - $300
    Bersegel
    $200 - $300
    0 penawaran
    Perl Upload.cgi Berakhir left

    Need to transfer a unix - script to an win2000 machine. It`s an upload script. ## Deliverables The script must be checked - and then changed to work on a win2000 server. 1 function must be removed from the script. Please contact me for a copy of the file. ## Deadline information Only 320 lines of code for review. i think for an professional should

    $87 (Avg Bid)
    $87 Rata-rata
    8 penawaran
    Perl Trainer Wanted Berakhir left

    Possible week long training in London. Please e-mail with day rates etc.

    $200 - $300
    Bersegel
    $200 - $300
    0 penawaran

    Wanted hardcore serious experieced PERL programmers who should possess good OOP knowledge. Preference would be given to the people familiar with some of the important PERL modules. CGI programming knowledge is a plus. Contact without CV mentioning total years of experience and nationality. Location is UK/EU. Foreign nationals [login untuk melihat URL] azsx109@onebox

    $200 - $300
    Bersegel
    $200 - $300
    0 penawaran

    We require a freelance programmer to make small modifications to an ‘off the shelf’ perl script. Working remotely, in your own time our requirements are as follows: 1. Once the customer has placed the product(s) in to the basket, the final page, which collects the customer information, will be located on a remote secure server ([login untuk melihat URL]) We

    $200 - $300
    Bersegel
    $200 - $300
    0 penawaran

    [login untuk melihat URL]

    $200 - $300
    Bersegel
    $200 - $300
    0 penawaran

    ... I need a perl cgi script made. Basically, the perl script will verify a list of email addresses, and save the valid ones to a text file. I have found a perl module at [login untuk melihat URL] that I think does this. What I am wanting is for someone to take this module, or make their own, and provide to me a fully-functioning script, ready for

    $200 - $300
    Bersegel
    $200 - $300
    0 penawaran
    Perl Development Berakhir left

    We need to have a script built that will take information supplied in a form and then build a HTML page automatically into the correct directory structure on our servers. Would be interested in hearing from anyone that thinks they can do this. I very good example is NetCard located at [login untuk melihat URL]

    $200 - $300
    Bersegel
    $200 - $300
    0 penawaran

    ...a "low cost" CGI/Perl programmer to do two projects which may involve hacking existing scripts. Our budget is very limited, however, we are prepared to off-set the difference with advertising on our site including free job/project referrals. [login untuk melihat URL] will soon begin helping businesses and individuals find, compare and select web products and services

    $200 - $300
    Bersegel
    $200 - $300
    0 penawaran
    PHP/Perl Developer Berakhir left

    ...based Internet Consultancy specialising in small to large company Web Sites, due to expansion are seeking an experienced Lead/Senior Programmer to compliment our existing team. 2 x Perl, PHP, MYSQL developers with experience for programming for database dynamic driven E-commerce Web Sites. One more senior 3 years + and one junior with System Administration

    $200 - $300
    Bersegel
    $200 - $300
    0 penawaran

    Hi We have a requirement for a perl contrator to do some 'polishing' to existing code and to create some new modules. This person needs to based in the UK, either in Hampshire or Berkshire. The following skills are ideal: Perl, Unix, CGI Please drop me a mail or call for a chat on: 01256 411344 07989 140124 Thanks! Mark Hughes [login untuk melihat URL]

    $200 - $300
    Bersegel
    $200 - $300
    0 penawaran

    We require an individual with good, quality experience and skills working with perl and the CGI environment. In particular a full understanding of mod_perl and related performance issues and techniques. Work will involve design, migration and tuning of existing and new systems.

    $200 - $300
    Bersegel
    $200 - $300
    0 penawaran
    Perl CM system Berakhir left

    Hi We urgently require a experienced Perl programmer, to build a relatively simple Content Management System (mostly news articles) and a user database (access by username and password). We need someone to come in for a brief Wednesday 20th AM !! Please call JM Littman 0207 596 6700

    $200 - $300
    Bersegel
    $200 - $300
    0 penawaran

    I've been asked to develop the front end on a messaging site that will be wap enabled. If I'm going to take it on I need a good perl person to work with. You will be experienced with URLs of database driven sites using PHP/perl in your portfolio. If you know XML too I'll be particularly interested. For details of the job send in your skillset, URLs

    $200 - $300
    Bersegel
    $200 - $300
    0 penawaran
    basic perl script Berakhir left

    I'm looking for a freelance programmer to write me a form and a script. For an idea of what I'd like to achieve, take a look at the following page on [login untuk melihat URL] by phillip greenspun; [login untuk melihat URL] Scroll down the page a bit and you can see the readers comments. Phillip gives away the software that runs his site for free, but all

    $200 - $300
    Bersegel
    $200 - $300
    0 penawaran